py_idt_order

A python interface for creating IDT bulk oligo order forms in Excel.

You design oligos in python; IDT wants a spreadsheet. py_idt_order is the bit in between: describe an order in code, get an .xlsx you can upload to IDT’s bulk input page.

Install

pip install py-idt-order

A first order

from py_idt_order import IDTOrder

IDTOrder.settings["output_dir"] = "example_order"

order = IDTOrder()
order.add_oligo("Test_oligo_1", "ACGTACGTACGTACGTACGT")
order.save()

That writes example_order/<timestamp>_idt_order.xlsx.

Where to go next

• Usage — scales, purifications, defaults and overrides, and uploading to IDT.

• API reference — every public class and function.

• Changelog — what changed, newest first.